|
PROBLEM SET #6 |
1. Give the mRNA and polypeptide made from the following DNA (Hint: the upper strand is the template strand):
5' TCAAATCCCACCCAGTAACTCCAACGTCTCTGCCATACC 3'
3' AGTTTAGGGTGGGTCATTGAGGTTGCAGAGACGGTATGG 5'
2. Identify the function of each of the following components in protein synthesis:
a) Ribosomes
b) tRNA
c) amino-acyl tRNA synthetase
d) anticodon
e) stop codon
3. Dideoxy ATP is identical to deoxy ATP (dATP) except it is lacking a hydroxyl group (-OH) at the 3' position. What would be the effect of adding dideoxy ATP to a reaction where DNA polymerase is replicating DNA. What feature of DNA synthesis does this demonstrate?
4. Describe five general ways (besides direct regulation of an enzyme's activity) that a cell can regulate the amount of a particular enzyme.
5. Why must many eukaryotic mRNAs undergo splicing?
6. Under what circumstances will a change in a DNA base pair not result in a change in the amino acid of the specified protein?
7. What is an operon? Explain the following regulatory systems and give an example for each:
a) inducible operon
b) repressible operon
8. Describe the primary effect and type of mutation caused by each of the following:
a) X-rays
b) ultraviolet radiation
c) chemical mutagens
d) spontaneous events (errors in replication)
e) transposition
9. How many tRNA molecules are necessary to produce an entire polypeptide containing 120 amino acids (assume that a given tRNA is used only once)? How many nucleotides were there in the coding portion of the mRNA that specified this protein?
10. Is a virus alive or dead? Explain your answer.